View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4672_high_8 (Length: 400)
Name: NF4672_high_8
Description: NF4672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4672_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 381
Target Start/End: Original strand, 16955881 - 16956261
Alignment:
| Q |
1 |
gattagaaagaaacagggaaaacaacaataaaattttaaatgaatgtttgcttatgcgagggtaaatattgtagttttttggaattcgaannnnnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16955881 |
gattagaaagaaacagggaaaacaacaataaaattttaaatgaatgtttgcttatgcgagggtaaatattgtagttttttggaattcgaatttttttttt |
16955980 |
T |
 |
| Q |
101 |
aaaaattatcattgaagagattagtaggtttagtcacaatcatatcgccctttaaaatgtttccctcttaaaaatgaaaatcgttcaagaattacactca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16955981 |
aaaaattatcattgaagagattagtaggtttagtcacaatcatatcgccctttaaaatgtttccctcttaaaaatgaaaatcgttcaagaattacactca |
16956080 |
T |
 |
| Q |
201 |
taaatatgataactatgacnnnnnnnnnnnnnnnnnnnnnnntaacttggtaactcaagtcgaagggaggagagaagaaaaagattgataactcaaaatc |
300 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16956081 |
taaatatgataactatgacaaaagaaagagagaagaaaaaaataacttggtaactcaagtcgaagggaggagagaagaaaaagattgataactcaaaatc |
16956180 |
T |
 |
| Q |
301 |
tttttcgttgtaccaacacactaggcgtgagccttctatttatagagatttcacaattgtcgttgagaaacttggcgaaca |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16956181 |
tttttcgttgtaccaacacactaggcgtgagccttctatttatagagatttcacaattgtcgttgagaaacttggcgaaca |
16956261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University