View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4672_low_21 (Length: 248)
Name: NF4672_low_21
Description: NF4672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4672_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 963700 - 963929
Alignment:
| Q |
18 |
attttatccattgcttttcaatctagttgactttgcggcttctttccacacttcattttcttatatggctggtctcttaattggctcaatttgaagttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
963700 |
attttatccattgcttttcaatctagttgactttgcggcttctttccacacttcattttcttatatagctggtctcttaattggctcaatttgaagttgg |
963799 |
T |
 |
| Q |
118 |
tttactggtatcttgggtcaatggtttaacgttcaggatctctgagaaatttaggcaccacatttccactcaaaactttgaggcaacatgattatgagtc |
217 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||||||| ||||| ||||| || |||| |||||| || |
|
|
| T |
963800 |
tttactggtatcttgggtcaatggccaaacgttcaggatctctgagagatttagacaccacatttccacccaaaatcttgagacatcatgtttatgaatc |
963899 |
T |
 |
| Q |
218 |
ttctattttatatatccaacattttctcta |
247 |
Q |
| |
|
|||||| |||||||| |||||||||||||| |
|
|
| T |
963900 |
ttctatcttatatattcaacattttctcta |
963929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University