View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4672_low_22 (Length: 243)
Name: NF4672_low_22
Description: NF4672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4672_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 126 - 221
Target Start/End: Original strand, 12866383 - 12866478
Alignment:
| Q |
126 |
cagaacctataattgaccatcaattttgtcaaaaaataataataattgaccatcaatatgtgcaactgtgcattgatatatcaaacccttcttttc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12866383 |
cagaacctataattgaccatcaattttgtcaaaatataataataactgaccatcaatatgtgcaactgtgcattgatatatcaaacccttcttttc |
12866478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 12866306 - 12866383
Alignment:
| Q |
1 |
cacataatctttcgtattcagctattaatttgtccattgaccaataagagcaaaataccgtcttatagtattcctctc |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12866306 |
cacataatctttcgtattcagctattaatttgtccattgaccaataagagcaaaataccgtcttatagtattcctctc |
12866383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University