View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4674-Insertion-2 (Length: 153)
Name: NF4674-Insertion-2
Description: NF4674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4674-Insertion-2 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 2e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 7 - 153
Target Start/End: Complemental strand, 5177261 - 5177115
Alignment:
| Q |
7 |
ataaattagagaaagtgatacttgaaaagattagattgatggtttattcctcatattattgaatgtacatttatatattataggaagagggtgctttata |
106 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5177261 |
ataaattagagaaagtgatacttgaaaaaattagattgatggtttattcctcatattattgaatgtacatttatatattataggaagagggtgctttata |
5177162 |
T |
|
| Q |
107 |
actttataaagcgaatctttgatgcatttgttgatctctttgaactc |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5177161 |
actttataaagcgaatctttgatgcatttgttgatctctttgaactc |
5177115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University