View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4674-Insertion-3 (Length: 140)
Name: NF4674-Insertion-3
Description: NF4674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4674-Insertion-3 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 1e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 1e-63
Query Start/End: Original strand, 14 - 140
Target Start/End: Complemental strand, 55951368 - 55951242
Alignment:
| Q |
14 |
acacagagcgagtttagagttcaacaaaatgtcttaccatctttgctcttcctcttcccctcttttccacgacccactcaccatctcttcccgtaaattc |
113 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55951368 |
acacagagcgagtttagagttcaagaaaatgtcttaccatctttgctcttcctcttcccctcttttccacgacccactcaccatctcttcccgtaaattc |
55951269 |
T |
 |
| Q |
114 |
aaacttcgaaacttcccctcttccttt |
140 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
55951268 |
aaacttcgaaacttcccctcttccttt |
55951242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University