View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4674_high_5 (Length: 253)
Name: NF4674_high_5
Description: NF4674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4674_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 32082404 - 32082163
Alignment:
| Q |
1 |
atgctgcttcttcttttcctcttgatttcattgaatttgatgttcaggtatatttcaattctttcatctttctttcacaataatttcannnnnnnnnnaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32082404 |
atgctgcttcttcttttcctcttgatttcattgaatttgatgttcaggtatatttcaattctttcatctttctttcacaataatttcatttttttaa-aa |
32082306 |
T |
 |
| Q |
101 |
aatataaatcattatccgaaaaatacgaatattattagattagatttagaagcacgaacgtatgtcctttttccagtttcgatcgccgcgtatctgatct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32082305 |
aatataaatcattatccgaaaaatacgaatattattagattagatttagaagcacgaacgtatgtcctttttccagtttcggtcgccgcgtatctgatct |
32082206 |
T |
 |
| Q |
201 |
gaaatcaagccgctttttctgggtttcctattttgcccctatg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32082205 |
gaaatcaagccgctttttctgggtttcctattttgcccctatg |
32082163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University