View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4674_low_4 (Length: 341)
Name: NF4674_low_4
Description: NF4674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4674_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 1 - 324
Target Start/End: Original strand, 43540162 - 43540485
Alignment:
| Q |
1 |
ttggatgcactccaagctccttcattttgtatagaaatctcaaggcttctgtcatgttaccttccttacaataaccgcgtattatgataccgcaggttcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540162 |
ttggatgcactccaagctccttcattttgtatagaaatctcaaggcttctgtcatgttaccttccttacaataaccgcgtattatgataccgcaggttcg |
43540261 |
T |
 |
| Q |
101 |
ttcattaggcttcactttgttattatactgctgcattttcaatatcaacctttccgcattatctgtctcaccattctgagcaaacgccctcgccagtgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540262 |
ttcattaggcttcactttgttattatactgctgcattttcaatatcaacctttccgcattatctgtctcaccattctgagcaaacgccctcgccagtgtg |
43540361 |
T |
 |
| Q |
201 |
ttgtatgtgacaatgtccggctgcatgccagagttcaccattttatgcataacattccatgcctcttccaattcattcttggtacaccatgcttggatga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540362 |
ttgtatgtgacaatgtccggctgcatgccagagttcaccattttatgcataacattccatgcctcttccaattcattcttggtacaccatgcttggatga |
43540461 |
T |
 |
| Q |
301 |
gaatattatatgttctctcgttcg |
324 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
43540462 |
gaatattatatgttctctcattcg |
43540485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University