View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4675-Insertion-10 (Length: 131)
Name: NF4675-Insertion-10
Description: NF4675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4675-Insertion-10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 7e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 7e-50
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 42917105 - 42916998
Alignment:
| Q |
8 |
agggttttggtagaaggtgctacgaagatggagttgagttcgaagcgggaaatggtcactctgtatttcttacac-ttttcgttgaaatcgaggtgtcct |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42917105 |
agggttttggtagaaggtgctacgaagatggagttgagttcgaagcgggaaatggtcactctgtatttcttacactttttcgttgaaatcgaggtgtcct |
42917006 |
T |
|
| Q |
107 |
ctgttttc |
114 |
Q |
| |
|
|||||||| |
|
|
| T |
42917005 |
ctgttttc |
42916998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University