View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4675-Insertion-11 (Length: 121)
Name: NF4675-Insertion-11
Description: NF4675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4675-Insertion-11 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 7e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 7e-59
Query Start/End: Original strand, 7 - 121
Target Start/End: Original strand, 31243230 - 31243344
Alignment:
| Q |
7 |
agaaccagcatttgtttcactaccatttgactgatccctggcttggttttcatagattcctgcagcgacattttcttctacaatgtcttcataaatgtac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31243230 |
agaaccagcatttgtttcactaccatttgactgatccctggcttggttttcatagattcctgcagcgacattttcttctacaatgtcttcataaatgtac |
31243329 |
T |
|
| Q |
107 |
ctcaactggtttaat |
121 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
31243330 |
ctcaactggtttaat |
31243344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 86; Significance: 1e-41; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 7 - 112
Target Start/End: Original strand, 7206486 - 7206591
Alignment:
| Q |
7 |
agaaccagcatttgtttcactaccatttgactgatccctggcttggttttcatagattcctgcagcgacattttcttctacaatgtcttcataaatgtac |
106 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7206486 |
agaaccagcatttgtttcactactagttgactgatccctggcttggctgtcatagattcctgcagcgacattttcttctacaatatcttcataaatgtac |
7206585 |
T |
|
| Q |
107 |
ctcaac |
112 |
Q |
| |
|
|||||| |
|
|
| T |
7206586 |
ctcaac |
7206591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University