View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4675-Insertion-8 (Length: 429)
Name: NF4675-Insertion-8
Description: NF4675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4675-Insertion-8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 347; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 8 - 377
Target Start/End: Original strand, 43514223 - 43514593
Alignment:
| Q |
8 |
caccggtgtagcggagcttgccgtcggtgaggcgggggaggatttttccgccgtagctaaagaggaacttgattgtatttttggggtatgattccatgtt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43514223 |
caccggtgtagcggagcttgccgtcggtgaggcgggggaggatttttccgccgtagctaaagaggaacttgattgtatttttggggtatgattccatgtt |
43514322 |
T |
|
| Q |
108 |
ggttaattagttaagagttacgtggaagaagagacgaggaagaagcgacaaaggagggatattgtttttgggactaggaaatgttggtgcttgaaaacac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43514323 |
ggttaattagttaagagttacgtggaagaagagacgaggaagaagcgacaaaggagggatattgtttttgggactaggaaatgttggtgcttgaaaacac |
43514422 |
T |
|
| Q |
208 |
-ttgttcatgggtttcgtggatatttataggaggaagcatgcgtcacgttaaggtaaagcaagcttacatggacaaatacccgtatagtaaatcacacaa |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43514423 |
tttgttcatgggtttcgtggatatttataggtggaagcatgcgtcacgttacggtaaagcaagcttacatggacaaatacccgtatagtaaatcacacaa |
43514522 |
T |
|
| Q |
307 |
catggcaagttgccaacacgtgtcatggtatcaattaagaatagaatgaaataatcatacgtttattttat |
377 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43514523 |
catggcaagttgccaacacgcgtcatggtatcaattaagaatagaataaaataatcatacgtttattttat |
43514593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 369 - 429
Target Start/End: Original strand, 43514787 - 43514847
Alignment:
| Q |
369 |
ttattttatcccgtaaaattaattattttatcaaaaaatatatgataaagtttcttttggg |
429 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43514787 |
ttattttatcccgtaaaattaattattttatcaaaaaatatatgataaagtttcttttggg |
43514847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University