View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4675_high_10 (Length: 243)
Name: NF4675_high_10
Description: NF4675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4675_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 19 - 200
Target Start/End: Original strand, 41285085 - 41285266
Alignment:
| Q |
19 |
aatgtctcatgcttcaaaccaccaaattttcgtgctcgggtctgtaatgattttcaatgtttgatttcttctctgtgaagtcaatctgctggaacattct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41285085 |
aatgtctcatgcttcaaaccaccaaattttcgtgttcgggtctgtaatgattttcaatgtttgattttttctctgtgaagtcaatctgctggaacattct |
41285184 |
T |
|
| Q |
119 |
ttagtataatttcttctttatatccttttggagttcaagtttgtgagcatgccaggcaatattgtcatcccattgactattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41285185 |
ttagtataatttcttctttatatccttttggagttcaagtttgtgagcatgccaggcaatattgtcatcccattgactattg |
41285266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University