View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4675_high_6 (Length: 333)
Name: NF4675_high_6
Description: NF4675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4675_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 11 - 315
Target Start/End: Original strand, 18716143 - 18716447
Alignment:
| Q |
11 |
aatgagatgaattgagaaaatccaaggttggatatgatggttcagcttgagctaaagtttgtgttggtggggatcttatgaaaacaccaacgttgttgtt |
110 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18716143 |
aatgacatgaattgagaaaatccaaggttggatatgatggttcagcttgagctaaagtttgtgttggtggggatcttttgaaaacaccaacgttgttgtt |
18716242 |
T |
 |
| Q |
111 |
gttgatgttttttgaggtataacaatcatgtttcaaaattccactttcttcaccaccatcataaaaaaccttagttataggtttattagattcatcatgg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18716243 |
gttgatgttttttgaggtataacaatcatgtttcaaaattccactttcttcaccaccatcataaaaaaccttagtgataggtttattagattcatcatgg |
18716342 |
T |
 |
| Q |
211 |
taagtcacataagtgtaatcttctggacttccaacaagaatctcatttgcaaaatttccattttgttgttgatgattttgaatcggaattgtgatcggtt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
18716343 |
taagtcacataagtgtaatcttctggacttccaacaagaatctcatttgcaaaatttccattttgttggtgatgattttgaattggaattgtgatcggtt |
18716442 |
T |
 |
| Q |
311 |
ctcct |
315 |
Q |
| |
|
||||| |
|
|
| T |
18716443 |
ctcct |
18716447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University