View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4675_high_7 (Length: 275)
Name: NF4675_high_7
Description: NF4675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4675_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 133 - 257
Target Start/End: Complemental strand, 22235316 - 22235192
Alignment:
| Q |
133 |
tatcaattattcaaagaacctaaaatgttgttttttctttgcttataacagtgactgcagggagtattcattaaccatctactgaaagtagttaatcaaa |
232 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22235316 |
tatcaattattcaaagaacctaaaaagttgttttttctttgcttataacagtgactgcagggagtattcattaaccatctactgaaagtagttaatcaaa |
22235217 |
T |
|
| Q |
233 |
caattttgatgtcaaattgtgtgtc |
257 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
22235216 |
taattttgatgtcaaattgtgtgtc |
22235192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 28 - 140
Target Start/End: Original strand, 635843 - 635955
Alignment:
| Q |
28 |
aaacagcatatgccaactgattagaacaacatcctaaattgtttaagttgacattttgatcatgaagtgaccaatagactacaataaccaattagaacat |
127 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
635843 |
aaacagcctatgccaactgattagaacaacatcctaaattgtttaagttgacattttgatcatgaagtgaccaatagactacaataaccaattagaacat |
635942 |
T |
|
| Q |
128 |
gcttctatcaatt |
140 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
635943 |
gcttctttcaatt |
635955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University