View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4676_high_26 (Length: 230)
Name: NF4676_high_26
Description: NF4676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4676_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 20 - 153
Target Start/End: Original strand, 45966042 - 45966175
Alignment:
| Q |
20 |
gaagaagaagagcttcaaacagtgagtttgttgacttgaatgatcaagtttcaatgtgttcgggattagcaccaattgctcaaaccgcatacggtgccgc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45966042 |
gaagaagaagagcttcaaacagtgagtttgttgacttgaatgatcaagtttcaatgtgttcgggattagcaccaattgctcaaaccgcatacggtgccgc |
45966141 |
T |
|
| Q |
120 |
cgccacctccagtggcggtgggagtggtggaaat |
153 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||| |
|
|
| T |
45966142 |
cgccacctccagtggcggtggtagtggtgaaaat |
45966175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University