View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4676_low_17 (Length: 280)
Name: NF4676_low_17
Description: NF4676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4676_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 25 - 269
Target Start/End: Original strand, 34909227 - 34909471
Alignment:
| Q |
25 |
attcactcgtcaatcatggtccatgtctccttcctcctcctcgttcaaattcagacctcttcctctcgttcctacttccgatctttctcctcctcaagcc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34909227 |
attcactcgtcaatcatggtccatgtctccttcctcctcctctttcaaattcagacctcttcctctcgttcctacttccgatctttctcctcctcaagcc |
34909326 |
T |
|
| Q |
125 |
acttccgtccccgaaagcgccggtgactcctccgccgagtctagttcgttgctcaaaactcttcagcttggatccttgttcggtttatggtacctcttta |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34909327 |
acttccgtccccgaaagcgccggtgactcctccgccgagtctagttcgttgctcaaaactcttcagcttggatccttgttcggtttatggtacctcttta |
34909426 |
T |
|
| Q |
225 |
acatctacttcaatatttacaacaaacaggtactacttcattctt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34909427 |
acatctacttcaatatttacaacaaacaggtactacttcattctt |
34909471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University