View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4676_low_19 (Length: 263)
Name: NF4676_low_19
Description: NF4676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4676_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 1760116 - 1760317
Alignment:
| Q |
1 |
aaatggatcttgtggtgtcatgcctggttttgatggtggtggtgacaatgaaaatgatgtagggacaagtggtggtggaatagaaatgcctggttggttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1760116 |
aaatggatcttgtggtgtcatgcctggttttgatggtggtggtgacaatgaaaatgatgtagggacaagtggtggtggaatagaaatgcctggttggttt |
1760215 |
T |
|
| Q |
101 |
gtgatgggaataggaggaggtgatagcattgaaaatgttggtgtttctgctaatggtggaggaattacaagaggtggtgggactaccgctggtagtgttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1760216 |
gtgatgggaataggaggaggtgatagcattgaaaatgttggtgtttctgctaatggaggaggaattacaagaggtggtgggactaccgctggtagtgttg |
1760315 |
T |
|
| Q |
201 |
gt |
202 |
Q |
| |
|
|| |
|
|
| T |
1760316 |
gt |
1760317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 22 - 57
Target Start/End: Original strand, 1760080 - 1760115
Alignment:
| Q |
22 |
gcctggttttgatggtggtggtgacaatgaaaatga |
57 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1760080 |
gcctggtgttgatggtggtggtgacaatgaaaatga |
1760115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University