View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4676_low_24 (Length: 240)
Name: NF4676_low_24
Description: NF4676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4676_low_24 |
 | |
|
| [»] scaffold1838 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 197
Target Start/End: Original strand, 22077789 - 22077826
Alignment:
| Q |
160 |
tttacatgatgtgtgtatgataatgttatgtagaatga |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22077789 |
tttatatgatgtgtgtatgataatgttatgtagaatga |
22077826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1838 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold1838
Description:
Target: scaffold1838; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 196
Target Start/End: Original strand, 332 - 368
Alignment:
| Q |
160 |
tttacatgatgtgtgtatgataatgttatgtagaatg |
196 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
332 |
tttatatgatgtgtgtatgataatgttatgtagaatg |
368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 197
Target Start/End: Complemental strand, 32450355 - 32450318
Alignment:
| Q |
160 |
tttacatgatgtgtgtatgataatgttatgtagaatga |
197 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
32450355 |
tttatatgatgtgtgtatgataatgttatgtggaatga |
32450318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 197
Target Start/End: Complemental strand, 9537448 - 9537411
Alignment:
| Q |
160 |
tttacatgatgtgtgtatgataatgttatgtagaatga |
197 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
9537448 |
tttatatgatgtttgtatgataatgttatgtagaatga |
9537411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 197
Target Start/End: Complemental strand, 35762142 - 35762105
Alignment:
| Q |
160 |
tttacatgatgtgtgtatgataatgttatgtagaatga |
197 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
35762142 |
tttatatgatgtgtgtatgataatgttatgtggaatga |
35762105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 197
Target Start/End: Complemental strand, 28969270 - 28969238
Alignment:
| Q |
165 |
atgatgtgtgtatgataatgttatgtagaatga |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
28969270 |
atgatgtgtgtatgataattttatgtagaatga |
28969238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University