View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4676_low_8 (Length: 369)
Name: NF4676_low_8
Description: NF4676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4676_low_8 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 362
Target Start/End: Original strand, 34909471 - 34909832
Alignment:
| Q |
1 |
tttcatgagatctattttctcaatgtttattttaattacaataattgttttatttatacatttctttggagaagtcaactgtactctttaaatgaatttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34909471 |
tttcatgagatctattttctcaatgtttattttaattacaatttttgttttatttatacatttctttggagaagtcgactgtactctttaaatgaatttc |
34909570 |
T |
 |
| Q |
101 |
agttatttcaagggactaatctttttagttggtagttgtatcgtgttaacttgtgttttcgcaacggtgaagagtatgttgaatgtggattttgaacttg |
200 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34909571 |
agttatttcaatggattaatctttttagttggtagttgtatcgtattaacttgtgttttcgcaacggtgaagagtatgttgaatttggattttgaacttg |
34909670 |
T |
 |
| Q |
201 |
atgtgnnnnnnnnnnnngcaggttttgaaggcgtgtcatttccctgtaaccgtgactgtagttcaatttgctgttggaactgttcttgtaacctttatgt |
300 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34909671 |
atgtgttttttctttttgcaggttttgaaggcgtgtcatttccctgtaaccgtgactgtagttcaatttgctgttggaactgttcttgtaacctttatgt |
34909770 |
T |
 |
| Q |
301 |
gggctctaaatctctacaaaagacctaaaatcactggtgccatggtattttgctctctgctc |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34909771 |
gggctctaaatctctacaaaagacctaaaatcactggtgccatggtattttgctctctgctc |
34909832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 220 - 303
Target Start/End: Complemental strand, 289379 - 289296
Alignment:
| Q |
220 |
aggttttgaaggcgtgtcatttccctgtaaccgtgactgtagttcaatttgctgttggaactgttcttgtaacctttatgtggg |
303 |
Q |
| |
|
|||||||||||| |||| ||||| ||| || |||| ||||||| |||||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
289379 |
aggttttgaaggtttgtcttttccttgtgactgtgattgtagttgaatttgctattggaactattcttgtaacctttgtgtggg |
289296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 220 - 303
Target Start/End: Original strand, 18198418 - 18198501
Alignment:
| Q |
220 |
aggttttgaaggcgtgtcatttccctgtaaccgtgactgtagttcaatttgctgttggaactgttcttgtaacctttatgtggg |
303 |
Q |
| |
|
|||||||||||| |||| ||||| ||| || |||| ||||||| |||||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
18198418 |
aggttttgaaggtttgtcttttccttgtgactgtgattgtagttgaatttgctattggaactattcttgtaacctttgtgtggg |
18198501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University