View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4677_high_6 (Length: 254)
Name: NF4677_high_6
Description: NF4677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4677_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 17 - 249
Target Start/End: Original strand, 46441491 - 46441723
Alignment:
| Q |
17 |
atgatgtttgttaatcgataaatgacaacaaaaacaaattgaactaaagcgatgcatgtttatttttcaggaactagagattcctttcggtttcgacgaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46441491 |
atgatgtttgttaatcgataaatgacaacaaaaacaaattgaactaaagcgatgcatgtttatttttcaggaactagagattcctttcggtttcgacgaa |
46441590 |
T |
|
| Q |
117 |
ggtcggcatcggatgcatacgagaagaaaggccaaaatagatcaggcccttcttctcctttcgatgtgtgagaaatgagccaccacattttctcttctct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46441591 |
ggtcggcatcggatgcatacgagaagaaaggccaaaacaaatcaggcccttcttctcctttcgatgtgtgagaaatgagccaccacattttctcttctct |
46441690 |
T |
|
| Q |
217 |
ggaaactgaggatgttaccttttggcctttgct |
249 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
46441691 |
ggaaactgaggatgttcccttttggcctttgct |
46441723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 137 - 197
Target Start/End: Original strand, 37137325 - 37137385
Alignment:
| Q |
137 |
gagaagaaaggccaaaatagatcaggcccttcttctcctttcgatgtgtgagaaatgagcc |
197 |
Q |
| |
|
||||||| |||| ||| ||| || |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37137325 |
gagaagacaggcacaaacagaccaagcccttcttctcctttcgatgtgtgaaaaatgagcc |
37137385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University