View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4677_low_3 (Length: 269)
Name: NF4677_low_3
Description: NF4677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4677_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 7e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 125 - 252
Target Start/End: Original strand, 43441320 - 43441445
Alignment:
| Q |
125 |
tgttaaatacaccactctcaatataaatttcatctagatttcttagcaaatatttttagcatttttcactgaaatgttgtcattttggcaaaattctgga |
224 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
43441320 |
tgttaaatacaccactc--aatataaatttcatctagatttcttagcaaatatttttagcatttttcactaaaatgttgtcattttggcaaaattctcga |
43441417 |
T |
|
| Q |
225 |
tcgaagacgaggttgaggaccacatcct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
43441418 |
tcgaagacgaggttgaggaccacatcct |
43441445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University