View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4677_low_5 (Length: 259)
Name: NF4677_low_5
Description: NF4677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4677_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 25 - 210
Target Start/End: Original strand, 43441018 - 43441203
Alignment:
| Q |
25 |
aatcggatcaataattattccacctagaattttattaaatctttgcttagtaaatttttagtgcgcttaattaggccaataatggttgcaagtatgaatt |
124 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43441018 |
aatcagatcaataattattccacctagaattttattaaatctttgcttggtaaatttttagtgcgcttaattaggccaataatggttgcaagtatgaatt |
43441117 |
T |
|
| Q |
125 |
tccgacatgttcatatcgtagtagnnnnnnnacaatgaaaatctagctcattaaatagagaagcataaagacatggatgatatatg |
210 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43441118 |
tccgacatgttcatatcgtagtagtttttttacaatgaaaatctagctcattaaatagagaagcataaagacatggatgatatatg |
43441203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University