View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4678-Insertion-1 (Length: 281)
Name: NF4678-Insertion-1
Description: NF4678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4678-Insertion-1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 7 - 75
Target Start/End: Original strand, 3334723 - 3334791
Alignment:
| Q |
7 |
atacagcttaagcattcttgatttgcctattaccaaacaatggagtccttggtaccatgaaaaagaggt |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3334723 |
atacagcttaagcattcttgatttgcctattaccaaacaatggagtccttggtaccatgaaaaagaggt |
3334791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 149 - 281
Target Start/End: Original strand, 3334865 - 3334996
Alignment:
| Q |
149 |
gatcatattcctgagtatgacatatagatgatgcatttggcatgatgattcatttaannnnnnnnnnnnnnnnnnngtttgttggaataggtaagtggat |
248 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
3334865 |
gatcatattcctaagtatgacatatagatgatgcatttggtatgatgattcatttaatttttttgttttttttttt-tgtgttggaataggtaagtggat |
3334963 |
T |
 |
| Q |
249 |
ggtatcaagaatatgaaggacttacgtttgcta |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3334964 |
ggtatcaagaatatgaaggacttacgtttgcta |
3334996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University