View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4678_low_4 (Length: 244)
Name: NF4678_low_4
Description: NF4678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4678_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 44149093 - 44149323
Alignment:
| Q |
1 |
ataatctaaacatagaatccttcctcactacttaatttagccaattcctgcctgtaattagaatcacaggctttcaaatttccaactttgnnnnnnnttc |
100 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44149093 |
ataatctaaacatagaaaccttccacactactta-----gccaattcctgcctgtaattagaatcacaggctttcaaatttccaactttgaaaaaaattc |
44149187 |
T |
|
| Q |
101 |
aactaaaataatcatgatttttcttcatcactcaaacatcccaaattgatttctccattgctgaatcctcatttggaagatgatgatgaaaattattcat |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44149188 |
aactaaaataaacatgatttttcttcatcactcaaacatcccaaattgatttctccattgctgaatcctcatgtggaagatgatgatgaaaattattcat |
44149287 |
T |
|
| Q |
201 |
aatttccaacctctgttgtctcaatgcttccaatct |
236 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44149288 |
aatttccaacctctgttgactcaatgcttccaatct |
44149323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University