View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4679_high_12 (Length: 384)
Name: NF4679_high_12
Description: NF4679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4679_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 365
Target Start/End: Complemental strand, 54302970 - 54302606
Alignment:
| Q |
1 |
acatttttctgtaaatgttacggaagcagcaggaagtcatgattgtcatgtataaagtggcgaacggtgctccatatatacaggtttatcnnnnnnnatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
54302970 |
acatttttctgtaaatgttacggaagcagcaggaagtcatgattgtcatatataaagtggcgaacgatgctccatatatacaggtttatctttttttatt |
54302871 |
T |
 |
| Q |
101 |
ctgaaatcaccctttacttttttcaaaatgtcaagctctaaagttgccatcgtgttaactctttctttacattgaaattgtctgcagattagagaatttg |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
54302870 |
ctgaaatcaccctttacttttttcagaatgtcaagctctaaagttgccatagtgttagctctttctttacattcaaattgtctgcagattagagaatttg |
54302771 |
T |
 |
| Q |
201 |
ttgcagatcatttggctttaagaggtattgaagtctatattatcactacggcagctgattgtttttggagtgcatcaaatgatgaagacatttctgaact |
300 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54302770 |
ttgcggatcatttggctttaagaggtattgaagtccatattatcactacggcagctgattgtttttggagtgcatcaaatgatgaagacatttcttaact |
54302671 |
T |
 |
| Q |
301 |
caaatcaatttgaaaattggaaataatttattttctttgacagatggatcgattgatgaattttt |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54302670 |
caaatcaatttgaaaattggaaataatttattttctttgacagatggatcgattgatgaattttt |
54302606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 31306850 - 31306903
Alignment:
| Q |
179 |
tgtctgcagattagagaatttgttgcagatcatttggctttaagaggtattgaa |
232 |
Q |
| |
|
||||||||||||||||| ||||||||||| || |||| |||||||||||||| |
|
|
| T |
31306850 |
tgtctgcagattagagattttgttgcagaaaatatggcactaagaggtattgaa |
31306903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University