View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4680-Insertion-7 (Length: 366)
Name: NF4680-Insertion-7
Description: NF4680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4680-Insertion-7 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 8 - 366
Target Start/End: Complemental strand, 21592535 - 21592175
Alignment:
| Q |
8 |
gttagggtttgtggggtgaggagattgtgggaaagggagagagagggagaagagatagcgatgatgaggagtgtgggtttgagagnnnnnnnnnnnnnnn |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21592535 |
gttagggtttgtggggtgaggagattgtggaaaagggagagagagggagaagagatagcgatgatgaggagtgtgggtttgagaggttgttgttgttgtt |
21592436 |
T |
|
| Q |
108 |
nnnnnngagggaagaggagaaaaggtgaagggagtggtggagaagatggtgtgaaattgtttaggtcttcttctagcaatcttgatggtggtgctgcttc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21592435 |
gtgtgtgagggaagaggagaaaaggtgaagggagtggtggagaagatggtgtgaaattgtttaggtcttcttctagtaatcttgatggtggtgctgcttc |
21592336 |
T |
|
| Q |
208 |
tgttatcacatcttccatttttgaagaaa--atgctctgttatgt-ggtgtgagcacaataaacaaacaaataatgtgtgtctctctttgtagccgctcc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21592335 |
tgttatcacatcttccatttttgaagaaaatatgctctgttatgtgggtgtgagcacaataaacaaacaaagaatgtgtgtctctctttgtagccgctcc |
21592236 |
T |
|
| Q |
305 |
gtaaacctaaggtggagtggaggacaagatgagtttgatgagtttcacaaagcagagttaca |
366 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21592235 |
gtaaacctaaggtggagtgaaggacaagatgagtttgatgagtttcacaaagc-gagttaca |
21592175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 8 - 366
Target Start/End: Complemental strand, 21596652 - 21596292
Alignment:
| Q |
8 |
gttagggtttgtggggtgaggagattgtgggaaagggagagagagggagaagagatagcgatgatgaggagtgtgggtttgagagnnnnnnnnnnnnnnn |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21596652 |
gttagggtttgtggggtgaggagattgtggaaaagggagagagagggagaagagatagcgatgatgaggagtgtgggtttgagaggttgttgttgttgtt |
21596553 |
T |
|
| Q |
108 |
nnnnnngagggaagaggagaaaaggtgaagggagtggtggagaagatggtgtgaaattgtttaggtcttcttctagcaatcttgatggtggtgctgcttc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21596552 |
gtgtgtgagggaagaggagaaaaggtgaagggagtggtggagaagatggtgtgaaattgtttaggtcttcttctagtaatcttgatggtggtgctgcttc |
21596453 |
T |
|
| Q |
208 |
tgttatcacatcttccatttttgaagaaa--atgctctgttatgt-ggtgtgagcacaataaacaaacaaataatgtgtgtctctctttgtagccgctcc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21596452 |
tgttatcacatcttccatttttgaagaaaatatgctctgttatgtgggtgtgagcacaataaacaaacaaagaatgtgtgtctctctttgtagccgctcc |
21596353 |
T |
|
| Q |
305 |
gtaaacctaaggtggagtggaggacaagatgagtttgatgagtttcacaaagcagagttaca |
366 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21596352 |
gtaaacctaaggtggagtgaaggacaagatgagtttgatgagtttcacaaagc-gagttaca |
21596292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University