View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4680_high_14 (Length: 292)
Name: NF4680_high_14
Description: NF4680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4680_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 13 - 286
Target Start/End: Original strand, 33391993 - 33392267
Alignment:
| Q |
13 |
atactgagatatatttagtagagttaaccctttggttcttagcaaggttgagggtcacgccatgtttgctttacgaatggaggtggaatccgaggtggtg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33391993 |
atactgagatatatttagtagagttaaccctttggttcttagcaaggttgagggtcacaccatgtttgctttacgaatggaggtggaatccgaggtggtg |
33392092 |
T |
|
| Q |
113 |
tcttggtgacttagggtgagcagatttggctggagttttaacagggtgtgctgctggttttttgacagtctgcga-ggtgcagtatgcagcagaattctg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
33392093 |
tcttggtgacttagggtgagcagatttggctggagttttaacagggtgtgctgctggttttttgacagtctgcaagggtgcagtatgcagcagaattctg |
33392192 |
T |
|
| Q |
212 |
gtctgttttctgtttctttaccgcgcctgtttgtttgtgtatagggtggtggccgtagtgcctgtgtaccgttct |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33392193 |
gtctgttttctgtttctttaccgcgcctgtttgtgtgtgtatagggtggtggccgtagtgcctgtgtaccgttct |
33392267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 87 - 133
Target Start/End: Complemental strand, 18319914 - 18319868
Alignment:
| Q |
87 |
gaatggaggtggaatccgaggtggtgtcttggtgacttagggtgagc |
133 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18319914 |
gaatggagatggaatccgaggtggtgtcttggtgtcttagggtgagc |
18319868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University