View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4680_low_20 (Length: 239)
Name: NF4680_low_20
Description: NF4680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4680_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 4120638 - 4120859
Alignment:
| Q |
17 |
acttgcaaacttcttagtattgccctatatatttgtttacagggcagatcttgatcttcctccctaaacaaacatttcacagttgatttcatggttctct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4120638 |
acttgcaaacttcttagtattgccctatatatttgtttacagggcagatcttgatcttcctccctaaacaaacatttcacagttgatttcatggttctct |
4120737 |
T |
|
| Q |
117 |
catgtgaaatgttacttcaataatgaatgtttgcaaagtatcaactttaagtcttctaattaataatttaaaatgttcaagtcttgtgatgttgcaaaaa |
216 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4120738 |
catgtgaaatgttacttcaataatggatgtttgcaaagtatcaactttaagtcttctaattaataatttaaaatgttcaagtcttgtgatgttgcaaaaa |
4120837 |
T |
|
| Q |
217 |
ataagaggctcaacaaccacac |
238 |
Q |
| |
|
|||||| ||||||||||||||| |
|
|
| T |
4120838 |
ataagatgctcaacaaccacac |
4120859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University