View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4680_low_7 (Length: 332)
Name: NF4680_low_7
Description: NF4680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4680_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 201 - 316
Target Start/End: Original strand, 16758207 - 16758322
Alignment:
| Q |
201 |
atattgttgttatcacttgagatcatgtgactaattgatgagacgcatttatctgttttgatttgcaatactctaagcatgaaaaaaggagcttgataag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16758207 |
atattgttgttatcacttgagatcatgtgactaattgatgagacgcatttatctgttttgatttgcaatactctaagcaggaaaaaaggagcttgataag |
16758306 |
T |
 |
| Q |
301 |
aattgtgtttctttag |
316 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
16758307 |
aattgtgtttctttag |
16758322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 16758005 - 16758162
Alignment:
| Q |
1 |
aaaatctttagatgatgaagaagccttggagcaaccgattcccaaggttgagagatatggtctaacaaatagtatctagaactttgcattactctttatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16758005 |
aaaatctttagatgatgaagaagccttggagcaaccgattcccaaggttgagagatatggtctaacaaatagtatctagaactttgcattactctttatc |
16758104 |
T |
 |
| Q |
101 |
tgttac--nnnnnnnnnnnngtataatttggttgaattatgcaccacatcattgtgca |
156 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16758105 |
tgttactttttttttttttggtataatttggttgaattatgcaccacatcattgtgca |
16758162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University