View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4680_low_7 (Length: 332)

Name: NF4680_low_7
Description: NF4680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4680_low_7
NF4680_low_7
[»] chr8 (2 HSPs)
chr8 (201-316)||(16758207-16758322)
chr8 (1-156)||(16758005-16758162)


Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 201 - 316
Target Start/End: Original strand, 16758207 - 16758322
Alignment:
201 atattgttgttatcacttgagatcatgtgactaattgatgagacgcatttatctgttttgatttgcaatactctaagcatgaaaaaaggagcttgataag 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
16758207 atattgttgttatcacttgagatcatgtgactaattgatgagacgcatttatctgttttgatttgcaatactctaagcaggaaaaaaggagcttgataag 16758306  T
301 aattgtgtttctttag 316  Q
    ||||||||||||||||    
16758307 aattgtgtttctttag 16758322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 16758005 - 16758162
Alignment:
1 aaaatctttagatgatgaagaagccttggagcaaccgattcccaaggttgagagatatggtctaacaaatagtatctagaactttgcattactctttatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16758005 aaaatctttagatgatgaagaagccttggagcaaccgattcccaaggttgagagatatggtctaacaaatagtatctagaactttgcattactctttatc 16758104  T
101 tgttac--nnnnnnnnnnnngtataatttggttgaattatgcaccacatcattgtgca 156  Q
    ||||||              ||||||||||||||||||||||||||||||||||||||    
16758105 tgttactttttttttttttggtataatttggttgaattatgcaccacatcattgtgca 16758162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University