View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4681-Insertion-11 (Length: 126)
Name: NF4681-Insertion-11
Description: NF4681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4681-Insertion-11 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 4e-45; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 4e-45
Query Start/End: Original strand, 8 - 126
Target Start/End: Original strand, 45325899 - 45326011
Alignment:
| Q |
8 |
atagtatggtttatgaatcactcgatgtggggctttactctttagtctttagtcagcagcaccgactcactcgacatcttccctttctgttgttagaact |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
45325899 |
atagtatggtttatgaatcactcgatgtggggctttactctttagtctttagtcagcagcaccgactcacttgacatcttccctttctgttgt------t |
45325992 |
T |
|
| Q |
108 |
cacaatcttcccgttctca |
126 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
45325993 |
cacaatcttcccgttctca |
45326011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University