View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4681-Insertion-13 (Length: 226)
Name: NF4681-Insertion-13
Description: NF4681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4681-Insertion-13 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 8 - 226
Target Start/End: Original strand, 37667679 - 37667897
Alignment:
| Q |
8 |
accttctctcatcgtgctcactagctcatcttccttcaaatcttgcaaacccattaatgctgagttttttcttaaactctctaaagtgatcacacctttt |
107 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
37667679 |
accttctctcatcatgctcacaagctcatcttccttcaaatcttgcaaacccatcaatgctgagttttttcttagactctccaaagtgatcacacctttt |
37667778 |
T |
|
| Q |
108 |
tctttatccataagtaacttgaaaccattacatagttccttcattaaaccttcaccacctagcttattcgcgatcaccggtaacaaatcctcaaagtcaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37667779 |
tctttatccataagtaacttgaaaccattacatagttccttcattaaaccttcaccacctagcttattcgcgatcaccggtaacaaatcctcaaagtcaa |
37667878 |
T |
|
| Q |
208 |
ttcctttgccaatttcagc |
226 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
37667879 |
ttcctttgccaatttcagc |
37667897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 33 - 202
Target Start/End: Complemental strand, 21941607 - 21941438
Alignment:
| Q |
33 |
tcatcttccttcaaatcttgcaaacccattaatgctgagttttttcttaaactctctaaagtgatcacacctttttctttatccataagtaacttgaaac |
132 |
Q |
| |
|
|||||||||||||||||||| ||||||| | || | ||||| || ||||| || || || ||||||||||||||||| ||||| | || | || | |
|
|
| T |
21941607 |
tcatcttccttcaaatcttgtaaacccaaaacagcagcgttttgcctcaaactatccaatgttatcacacctttttctttgtccatcaacaattcaaatc |
21941508 |
T |
|
| Q |
133 |
cattacatagttccttcattaaaccttcaccacctagcttattcgcgatcaccggtaacaaatcctcaaa |
202 |
Q |
| |
|
|||| ||||| ||||| ||||||||||||||||||||||| || || ||||| |||||||| || ||||| |
|
|
| T |
21941507 |
cattgcatagctcctttattaaaccttcaccacctagcttgtttgccatcactggtaacaagtcttcaaa |
21941438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University