View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4681-Insertion-5 (Length: 411)
Name: NF4681-Insertion-5
Description: NF4681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4681-Insertion-5 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 8 - 411
Target Start/End: Original strand, 32022116 - 32022528
Alignment:
| Q |
8 |
actacctgtgtcaagaaccatgtagtagggttttggtggttggcctatgcctagtctggagaaatactcaccggagccggagccagaaccggaggaaact |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32022116 |
actacctgtgtcaagaaccatgtagtagggttttggtggttgacctatgcctagtctggagaaatactcaccggagccggagccagaaccggaggaaact |
32022215 |
T |
 |
| Q |
108 |
ggtgtggagagatcttcttgttgaagctcggtttgaaccgggtggagatcggttttcttgaggttgtttagagaaagtttgagttttgtagttagtgagt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32022216 |
ggtgtggagagatcttcttgttgaagctcggtttgaaccgggtggagatcggttttcttgaggttgtttagagaaagttcgagttttgtagttagtgagt |
32022315 |
T |
 |
| Q |
208 |
caactcgggctgagtcacgagtgagtctagcttgcataagttttgtatagtctttatggttttcattgagaagattctctcttggatgtatgagaattga |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32022316 |
caactcgggctgagtcacgagtgagtctagcttgcataagttttgtatagtctttatggttttcattgagaagattctctcttggatgtatgagaattga |
32022415 |
T |
 |
| Q |
308 |
gaaagatgatgaagagttttgta----gggttttttg--------ttcttcaagaagattattgttattagggttaaagttaaggacttgtttggttttg |
395 |
Q |
| |
|
|||| |||||||||||| | |||||||| | |||||||| ||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32022416 |
gaaa---gatgaagagtttgaaaaaacgggtttttggtttagggtttcttcaacaagattaatgttattagggttaaagttaaggacttgtttggtttgg |
32022512 |
T |
 |
| Q |
396 |
tgaattgaggaagaga |
411 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
32022513 |
tgaattgaggaagaga |
32022528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University