View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4681_high_11 (Length: 470)
Name: NF4681_high_11
Description: NF4681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4681_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 408; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 408; E-Value: 0
Query Start/End: Original strand, 17 - 457
Target Start/End: Original strand, 43463414 - 43463854
Alignment:
| Q |
17 |
atgaagcaattagagaaggatttataaatgatccaaaaggtgaagtgaacatgtctgcaatgtggctagtacctcaacattgcttagttggtttagctga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43463414 |
atgaagcaattagagaaggatttataaatgatccaaaaggtgtagtgaacatgtctgcaatgtggctagtacctcaacattgcttagttggtttagctga |
43463513 |
T |
|
| Q |
117 |
ggcattcagtgcaattggacaaattgagnnnnnnnactctcaatttcctaaaagtatgtctagtattgctgtttcactttttactcttggatttgggaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43463514 |
ggcattcagtgcaattggacaaattgagtttttttactctcaatttcctaaaagtatgtctagtattgctgtttcactttttactcttggatttgggaca |
43463613 |
T |
|
| Q |
217 |
ggaaatttggtggctagcattatagttaagtctgttaaaaatgggacacaaagaggaggtcaagttagttggttatcagcaaatatcaatcaagggcact |
316 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43463614 |
ggaaatttggtggctaccattatagttaagtctgttaaaaatgggacacaaagaggaggtcaagttagttggttatcagcaaatatcaatcaagggcact |
43463713 |
T |
|
| Q |
317 |
atgattactactattggctccttactattctaagtttggtgaatatgttttacttcttcttgtgtagctgggcttatgggagtactgaagatataaaaaa |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43463714 |
atgattactactattggctccttactattctaagtttggtgaatatgttttacttcttgttgtgtagctgggcttatgggagtactgaagatataaaaaa |
43463813 |
T |
|
| Q |
417 |
ttgggatgaagaggttgatacaaaatctgaaatgtcaaaat |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43463814 |
ttgggatgaagaggttgatacaaaatctgaaatgtcaaaat |
43463854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University