View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4681_high_40 (Length: 332)
Name: NF4681_high_40
Description: NF4681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4681_high_40 |
 |  |
|
| [»] scaffold0045 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0045 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 17 - 303
Target Start/End: Original strand, 33181 - 33466
Alignment:
| Q |
17 |
atggccaatgttgcggcttttgttttcaggaaagctgcaaatgaagtcgattataaaggtacattgaattggttgccgatcttaagaaagttacagaatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33181 |
atggccaatgttgcggcttttgttttcaggaaagctgcaaatgaagtcgattataaaggtacattgaattggttgccgatcttaagaaagttacagaatt |
33280 |
T |
 |
| Q |
117 |
ttgtctcaatttttcttttgcaagaaaataaatatttgtctctttttctgtcattctaaaccttcatttcaatcttctaattattatccnnnnnnnnngc |
216 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||||||||| |||||||| || |
|
|
| T |
33281 |
ttgtctctatttttcttttgcaagaaaataaataattatctctttttctgtcattataaaccttcatttcaatcttctaa-tattatcctttttttttgc |
33379 |
T |
 |
| Q |
217 |
tgtcaagtaatctagtaagatagaaattcagtttttaaagctgaataagttaagtgtctaagatttgaactccaaatatttattatg |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33380 |
tgtcaagtaatctagtaagatagaaattcagtttttaaagctgaataagttaagtgtctaagatttgaactccaaatatttattatg |
33466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 17 - 76
Target Start/End: Original strand, 40648 - 40707
Alignment:
| Q |
17 |
atggccaatgttgcggcttttgttttcaggaaagctgcaaatgaagtcgattataaaggt |
76 |
Q |
| |
|
|||||||||||| || ||||||||||||| |||| || |||||||||||||||||||||| |
|
|
| T |
40648 |
atggccaatgtttcgtcttttgttttcagaaaagttgtaaatgaagtcgattataaaggt |
40707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University