View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4681_high_43 (Length: 304)

Name: NF4681_high_43
Description: NF4681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4681_high_43
NF4681_high_43
[»] chr2 (4 HSPs)
chr2 (18-296)||(16231305-16231583)
chr2 (18-117)||(34690143-34690242)
chr2 (18-117)||(34712555-34712654)
chr2 (160-198)||(35889737-35889775)
[»] chr1 (9 HSPs)
chr1 (55-117)||(7891867-7891929)
chr1 (56-117)||(38138776-38138837)
chr1 (58-117)||(50911744-50911803)
chr1 (52-117)||(43083147-43083212)
chr1 (52-117)||(43044303-43044368)
chr1 (52-117)||(43067623-43067688)
chr1 (52-117)||(43077500-43077565)
chr1 (71-117)||(45984624-45984670)
chr1 (56-117)||(3300037-3300098)
[»] chr6 (2 HSPs)
chr6 (52-117)||(7530171-7530236)
chr6 (52-117)||(7520634-7520699)
[»] chr4 (2 HSPs)
chr4 (52-111)||(4230774-4230833)
chr4 (83-119)||(19965470-19965506)
[»] chr8 (1 HSPs)
chr8 (56-117)||(4618992-4619053)


Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 18 - 296
Target Start/End: Complemental strand, 16231583 - 16231305
Alignment:
18 ttcctatgaagcctatggtggaggtgggcatcaatgaatatccttcccttggtcgttttgctgtcagagacatgcgtcaaactgtggctgttggagtcat 117  Q
    ||||||||||||||||||||| || ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16231583 ttcctatgaagcctatggtggtggagggtatcaatgaatatccttcccttggtcgttttgctgtcagagacatgcgtcaaactgtggctgttggagtcat 16231484  T
118 aatgtctgtaaataagaatggttataagaacaaggcagcgacaaagatgaccggttccacgactgatcagaaagatgatgctgaaacttcatcaaagaaa 217  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16231483 aatgtctgtaaagaagaatggttataagaacaaggcagcgacaaagatgaccggttccacgactgatcagaaagatgatgctgaaacttcatcaaagaaa 16231384  T
218 agaaaagaaggactgtttgaaacagtttccgctgaaacgccatccaagaatgtatcaggtctagttattggtgatgatg 296  Q
    ||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||    
16231383 agaaaagaaggaccgtttgaaacagtttctgctgaaacgccatccaagaatgtatcaggtctagttattggcgatgatg 16231305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 18 - 117
Target Start/End: Complemental strand, 34690242 - 34690143
Alignment:
18 ttcctatgaagcctatggtggaggtgggcatcaatgaatatccttcccttggtcgttttgctgtcagagacatgcgtcaaactgtggctgttggagtcat 117  Q
    |||||||||| || ||||| | || ||| |||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| ||||    
34690242 ttcctatgaaacccatggtcgtggagggtatcaatgaatatccatcccttggccgttttgctgtcagagacatgcgtcaaactgtggctgttggaatcat 34690143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 18 - 117
Target Start/End: Complemental strand, 34712654 - 34712555
Alignment:
18 ttcctatgaagcctatggtggaggtgggcatcaatgaatatccttcccttggtcgttttgctgtcagagacatgcgtcaaactgtggctgttggagtcat 117  Q
    |||||||||| || ||||| | || ||| |||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| ||||    
34712654 ttcctatgaaacccatggtcgtggagggtatcaatgaatatccatcccttggccgttttgctgtcagagacatgcgtcaaactgtggctgttggaatcat 34712555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 198
Target Start/End: Original strand, 35889737 - 35889775
Alignment:
160 aaagatgaccggttccacgactgatcagaaagatgatgc 198  Q
    |||||||| |||||| |||||||||||||||||||||||    
35889737 aaagatgatcggttctacgactgatcagaaagatgatgc 35889775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 9)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 55 - 117
Target Start/End: Original strand, 7891867 - 7891929
Alignment:
55 atatccttcccttggtcgttttgctgtcagagacatgcgtcaaactgtggctgttggagtcat 117  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||    
7891867 atatccttcacttggtcgttttgctgtcagagacatgcgtcaaactgtggctattggagtcat 7891929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 56 - 117
Target Start/End: Original strand, 38138776 - 38138837
Alignment:
56 tatccttcccttggtcgttttgctgtcagagacatgcgtcaaactgtggctgttggagtcat 117  Q
    |||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||||||    
38138776 tatcctccacttggccgttttgctgtcagagacatgcgtcaaactgtggctgttggagtcat 38138837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 58 - 117
Target Start/End: Complemental strand, 50911803 - 50911744
Alignment:
58 tccttcccttggtcgttttgctgtcagagacatgcgtcaaactgtggctgttggagtcat 117  Q
    |||||| || || |||||||||||||||||||||||||||||||||||||||||||||||    
50911803 tccttcactcggccgttttgctgtcagagacatgcgtcaaactgtggctgttggagtcat 50911744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 52 - 117
Target Start/End: Complemental strand, 43083212 - 43083147
Alignment:
52 tgaatatccttcccttggtcgttttgctgtcagagacatgcgtcaaactgtggctgttggagtcat 117  Q
    |||||||||| | || |||||||||||||| ||||||||||||||||||||||||||||| |||||    
43083212 tgaatatcctccactcggtcgttttgctgttagagacatgcgtcaaactgtggctgttggcgtcat 43083147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 52 - 117
Target Start/End: Complemental strand, 43044368 - 43044303
Alignment:
52 tgaatatccttcccttggtcgttttgctgtcagagacatgcgtcaaactgtggctgttggagtcat 117  Q
    |||||||||| | || || ||||||||||| ||||||||||||||||||||||||||||| |||||    
43044368 tgaatatcctccactcggccgttttgctgttagagacatgcgtcaaactgtggctgttggggtcat 43044303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 52 - 117
Target Start/End: Original strand, 43067623 - 43067688
Alignment:
52 tgaatatccttcccttggtcgttttgctgtcagagacatgcgtcaaactgtggctgttggagtcat 117  Q
    |||||||||| | || || ||||||||||| ||||||||||||||||||||||||||||| |||||    
43067623 tgaatatcctccactcggccgttttgctgttagagacatgcgtcaaactgtggctgttggcgtcat 43067688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 52 - 117
Target Start/End: Original strand, 43077500 - 43077565
Alignment:
52 tgaatatccttcccttggtcgttttgctgtcagagacatgcgtcaaactgtggctgttggagtcat 117  Q
    |||||||||| | ||||| |||||| || |||| |||| ||||||||||||||||||||| |||||    
43077500 tgaatatcctccacttggccgttttactatcagggacaagcgtcaaactgtggctgttggtgtcat 43077565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 71 - 117
Target Start/End: Original strand, 45984624 - 45984670
Alignment:
71 cgttttgctgtcagagacatgcgtcaaactgtggctgttggagtcat 117  Q
    ||||||| ||||||||||  || ||||||||||||||||||||||||    
45984624 cgttttgttgtcagagactggcatcaaactgtggctgttggagtcat 45984670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 56 - 117
Target Start/End: Complemental strand, 3300098 - 3300037
Alignment:
56 tatccttcccttggtcgttttgctgtcagagacatgcgtcaaactgtggctgttggagtcat 117  Q
    |||||| | ||||| ||||| |||||||| || |||||||| |||||||||||||| |||||    
3300098 tatcctccacttggccgtttcgctgtcagggatatgcgtcagactgtggctgttggtgtcat 3300037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 52 - 117
Target Start/End: Original strand, 7530171 - 7530236
Alignment:
52 tgaatatccttcccttggtcgttttgctgtcagagacatgcgtcaaactgtggctgttggagtcat 117  Q
    |||||||||| | ||||| |||||||||||||| ||||||||||||||||| |||||||| |||||    
7530171 tgaatatcctcctcttggacgttttgctgtcagggacatgcgtcaaactgttgctgttggtgtcat 7530236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 52 - 117
Target Start/End: Original strand, 7520634 - 7520699
Alignment:
52 tgaatatccttcccttggtcgttttgctgtcagagacatgcgtcaaactgtggctgttggagtcat 117  Q
    |||||||||| | ||||| |||||||| ||||| ||||||||||||||||| |||||||| |||||    
7520634 tgaatatcctcctcttggacgttttgccgtcagggacatgcgtcaaactgttgctgttggtgtcat 7520699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 52 - 111
Target Start/End: Complemental strand, 4230833 - 4230774
Alignment:
52 tgaatatccttcccttggtcgttttgctgtcagagacatgcgtcaaactgtggctgttgg 111  Q
    |||||||||| | ||||| ||||||||||||||||| ||||| |||||||||||||||||    
4230833 tgaatatcctccacttggccgttttgctgtcagagatatgcggcaaactgtggctgttgg 4230774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 83 - 119
Target Start/End: Original strand, 19965470 - 19965506
Alignment:
83 agagacatgcgtcaaactgtggctgttggagtcataa 119  Q
    |||||||||||||||||||||||| ||||||||||||    
19965470 agagacatgcgtcaaactgtggcttttggagtcataa 19965506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 56 - 117
Target Start/End: Complemental strand, 4619053 - 4618992
Alignment:
56 tatccttcccttggtcgttttgctgtcagagacatgcgtcaaactgtggctgttggagtcat 117  Q
    |||||||| || || |||||||||||||||||||| |||| ||| |||||||||||||||||    
4619053 tatccttcactcggccgttttgctgtcagagacatacgtcgaacagtggctgttggagtcat 4618992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University