View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4681_high_51 (Length: 256)
Name: NF4681_high_51
Description: NF4681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4681_high_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 134
Target Start/End: Original strand, 6942378 - 6942492
Alignment:
| Q |
18 |
tgaacgggagatgttgctggagtttcgctcaatgctggatgacttcgcaccatggtactttactaatacgatcaactctcctatgaatttcaatttagaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6942378 |
tgaacgggagatgttgctggagtttcgctcaatgct--acgacttcgcaccatggtactttgctaatacgatcaactctcctatgaatttcaatttagaa |
6942475 |
T |
 |
| Q |
118 |
ctctctcttggcgtttt |
134 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
6942476 |
ctctctcttggcgtttt |
6942492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University