View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4681_high_59 (Length: 238)
Name: NF4681_high_59
Description: NF4681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4681_high_59 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 6942606 - 6942832
Alignment:
| Q |
1 |
tttcttaatatgcaggtaatttacccaaccatgattattgagtgcatgtgctttaatgagaataaaatctattttaataataagttttatacgtgagata |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6942606 |
tttcttaatatgcaggtaatttacccagccatgattattgagtgcatgtgctttaatgagaataaaatctattttaataataagttttatacgtgagata |
6942705 |
T |
 |
| Q |
101 |
tttgcattgaggatcgttattggtgttggac----acatcacaaattgtgtttgaacaaaatgttgttttagttatcaccaagtttgatgcatgcattgt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6942706 |
tttgcattgaggatcgttattggtgttggacttggacatcacaaattgtgtttgaacaaaatgttgttttagttatcaccaagtttgatgcatgcattat |
6942805 |
T |
 |
| Q |
197 |
acttccagaaaaatggatgagataatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
6942806 |
acttccagaaaaatggatgagataatt |
6942832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University