View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4681_high_69 (Length: 213)
Name: NF4681_high_69
Description: NF4681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4681_high_69 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 23905116 - 23905327
Alignment:
| Q |
1 |
tagatgagagtattgaagttaatagtcctagaaacgtggttctgcatttgattaggaatataaatccggatatttgcactctgtctaatattaatggatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
23905116 |
tagatgagagtattgaagttaatagtcctagaaacgtggttctgcatttgattaggaagataaatccggatattttcgctctgtctattattaatggatc |
23905215 |
T |
 |
| Q |
101 |
atataattcacctttctttgcttcaaggtttagggaggcactgtttaatttttctgctatttatgatatgttggacgacgtcataccgaagggaagtgaa |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23905216 |
atataattcacctttctttgcgacaaggtttagggaggcactgtttaatttttctgctatttatgatatgttggacgccgtcataccgaagggaagtgaa |
23905315 |
T |
 |
| Q |
201 |
tggaggaggatg |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
23905316 |
tggaggaggatg |
23905327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 23921868 - 23921656
Alignment:
| Q |
1 |
tagatgagagtattgaagttaatagtcctagaaacgtggttctgcatttgattaggaatataaatccggatatttgcactctgtctaatattaatggatc |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
23921868 |
tagatgagagtattgagattaatagtcctagaaacgtggttctgcatttgattaggaagataaatccggatattttcactctgtctactattaatggatc |
23921769 |
T |
 |
| Q |
101 |
atataattcacctttctttgcttcaaggtttagggaggcactgtttaatttttctgctatttatgatatgttggacgacgtcataccgaagggaagtgaa |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
23921768 |
atataattcacctttctttgctacaaggtttagggaggcactgtttaatttttctgctatttatgatatgttggatgccgtcataccgaagggaagtgaa |
23921669 |
T |
 |
| Q |
201 |
tggaggaggatgc |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
23921668 |
tggaggaggatgc |
23921656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 3 - 172
Target Start/End: Complemental strand, 23911851 - 23911682
Alignment:
| Q |
3 |
gatgagagtattgaagttaatagtcctagaaacgtggttctgcatttgattaggaatataaatccggatatttgcactctgtctaatattaatggatcat |
102 |
Q |
| |
|
||||| ||||||||||| || ||||||||||||| |||||||||||| || || || |||||||| | ||||| || ||| | | |||||||||||| |
|
|
| T |
23911851 |
gatgaaagtattgaagtgaacagtcctagaaacgcggttctgcatttaatcagaaagataaatcctgctatttttgttcagtcaattgttaatggatcat |
23911752 |
T |
 |
| Q |
103 |
ataattcacctttctttgcttcaaggtttagggaggcactgtttaatttttctgctatttatgatatgtt |
172 |
Q |
| |
|
||||||| || ||||||||| || |||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
23911751 |
ataattcgccattctttgctacacggtttagggaggcactgtttcatttttctgctctttatgatatgtt |
23911682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University