View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4681_low_20 (Length: 398)
Name: NF4681_low_20
Description: NF4681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4681_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 74; Significance: 8e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 234 - 369
Target Start/End: Complemental strand, 29846265 - 29846129
Alignment:
| Q |
234 |
aaaaaagttttttgtattattacaataaacaag-tttttttgacgnnnnnnnnnnnnngaagaagaaggaaatagatgattcacgaacgttctttgcttc |
332 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
29846265 |
aaaaaagatttttgtattattacaataaacaagatttttttgacgaaaaaaaaaagaagaagaagaaggaaatagataattcacgaacgttctatgcttt |
29846166 |
T |
 |
| Q |
333 |
cagcgatccacaccaaaaacccttattaacttgtcac |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29846165 |
cagcgatccacaccaaaaacccttattaacttgtcac |
29846129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University