View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4681_low_23 (Length: 389)
Name: NF4681_low_23
Description: NF4681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4681_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 2e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 245 - 378
Target Start/End: Original strand, 27473613 - 27473746
Alignment:
| Q |
245 |
agttaatgtatgcttacatgatagaacacaagaaatatagtggacctttcttgctattgattttgaaaatgcatttatcattgtaatctcaaatttcttt |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27473613 |
agttaatgtatgcttacatgatagaacacaagaaatatagtggacctttcttgctattgattttgaaaatgcatttatcattgcaatctcaaatttcttt |
27473712 |
T |
|
| Q |
345 |
ccttacccttctatacatgatcattcctcttctt |
378 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
27473713 |
acttatccttctatacatgatcattcctcttctt |
27473746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 7e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 296 - 378
Target Start/End: Original strand, 19856029 - 19856111
Alignment:
| Q |
296 |
tgctattgattttgaaaatgcatttatcattgtaatctcaaatttctttccttacccttctatacatgatcattcctcttctt |
378 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| || ||| |||||||| ||||||||||||||||||| |
|
|
| T |
19856029 |
tgctattgattttgaaaatgcatttctcattgtaatctcaaatttcattatttatccttctatgcatgatcattcctcttctt |
19856111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University