View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4681_low_29 (Length: 352)
Name: NF4681_low_29
Description: NF4681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4681_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 20 - 276
Target Start/End: Original strand, 3810661 - 3810919
Alignment:
| Q |
20 |
gtcacagattatcttcaaagttttaatgcatcattagcatgattacaatgagaatgcaatgcaagtgttttgtgcttgctctgttcaccnnnnnnnn--c |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
3810661 |
gtcacatattatcttcaaagttttaatgcatcattagcatgattacaatgagaatgcaatgcaagtgttttgtgcttgctttgttcaccttttttttttc |
3810760 |
T |
 |
| Q |
118 |
ctagtttcgaactttatagagctagtttgtcatttttaagggattttgttgttcttaggatttaatccttgctactttcattattaatgatattgttttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810761 |
ctagtttcgaactttatagagctagtttgtcatttttaagggattttgttgttcttaggatttaatccttgctactttcattattaatgatattgttttc |
3810860 |
T |
 |
| Q |
218 |
accttnnnnnnnttgcagaagtgttactccaatttgatttatgcgcttcaggaatcaag |
276 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
3810861 |
accttaaaaaaattgcagaagtgttactccaatttgatttatacgcttcaagaatcaag |
3810919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University