View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4681_low_48 (Length: 265)
Name: NF4681_low_48
Description: NF4681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4681_low_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 15 - 255
Target Start/End: Complemental strand, 28677501 - 28677262
Alignment:
| Q |
15 |
ataattgtcaaagtatgaacaattttcaagtaccattagtccgtagaccatacgaaatacttctcctctctagctatcacttgcatattataacatattt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28677501 |
ataattgtcaaagtatgaacaattttcaagtaccgttagtccgtagaccatacaagatacttctcctctctagctatcacttgcatattataacatattt |
28677402 |
T |
 |
| Q |
115 |
ctccttagatatttaggtaaatttaagattttttaagcaattaggtttccatgaaaaaattgttaatagttcatgtatcaggctaatagttaaggaaaca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28677401 |
ctccttagatatttaggtaaatttaagattttttaaggaattaggtttccatgaaaaaattgtt-atagttcatgtatcaggctaatagttaaggaaaca |
28677303 |
T |
 |
| Q |
215 |
ttcatttttgagtcttttgattaagtcgaaaaatatctctg |
255 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28677302 |
ttcatttttgagtcttttgattaagttgaaaaatatctctg |
28677262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University