View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4681_low_51 (Length: 256)

Name: NF4681_low_51
Description: NF4681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4681_low_51
NF4681_low_51
[»] chr2 (1 HSPs)
chr2 (18-134)||(6942378-6942492)


Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 134
Target Start/End: Original strand, 6942378 - 6942492
Alignment:
18 tgaacgggagatgttgctggagtttcgctcaatgctggatgacttcgcaccatggtactttactaatacgatcaactctcctatgaatttcaatttagaa 117  Q
    ||||||||||||||||||||||||||||||||||||  | ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
6942378 tgaacgggagatgttgctggagtttcgctcaatgct--acgacttcgcaccatggtactttgctaatacgatcaactctcctatgaatttcaatttagaa 6942475  T
118 ctctctcttggcgtttt 134  Q
    |||||||||||||||||    
6942476 ctctctcttggcgtttt 6942492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University