View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4681_low_62 (Length: 238)
Name: NF4681_low_62
Description: NF4681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4681_low_62 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 52855016 - 52855237
Alignment:
| Q |
1 |
cctcagcagcatgtgtatcccttaactgttccgtgtgtgtaatcaaatgtttgttggtgatgaaacttgaagttaactacactttacttttcggccttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52855016 |
cctcagcagcatgtgtatcccttaactgttccgtgtgtgtaatcaaatgtttgttggtgatgaaacttgaagttaactacactttacttttcggccttca |
52855115 |
T |
 |
| Q |
101 |
acaatgtttcttccgcatgctgtctcctaaaactattaatcagcataggtaaacaagatatttgttggactaataccagtttgaaattgcatcatgcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52855116 |
acaatgtttcttccgcatgctgtctcctaaaactattaatcagcatagctaaacaagatatttgttgaactaataccagtttgaaattgcatcatgcaaa |
52855215 |
T |
 |
| Q |
201 |
tgaaacataataaccaaaaaac |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
52855216 |
tgaaacataataaccaaaaaac |
52855237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 132 - 220
Target Start/End: Original strand, 48485703 - 48485791
Alignment:
| Q |
132 |
actattaatcagcataggtaaacaagatatttgttggactaataccagtttgaaattgcatcatgcaaatgaaacataataaccaaaaa |
220 |
Q |
| |
|
||||||||| | ||||| |||||||| |||||||||||||||||||||||||| || ||| || || | |||||||||||||||||| |
|
|
| T |
48485703 |
actattaataatcatagctaaacaaggtatttgttggactaataccagtttgacatctcattttgtaagttaaacataataaccaaaaa |
48485791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University