View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4681_low_69 (Length: 217)
Name: NF4681_low_69
Description: NF4681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4681_low_69 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 17 - 197
Target Start/End: Complemental strand, 13309176 - 13308996
Alignment:
| Q |
17 |
agtatatagatcaagtgaagtacttactaagttactatcactaggataaatggatcatatatcataataattcataacttttgtgtatacattattaggg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13309176 |
agtatatagatcaagtgaagtacttactaagttactatcactaggataaatggatcatatatcataatcattcataacttttgtgtatacattattaggg |
13309077 |
T |
|
| Q |
117 |
agcagaaccattgcaacaacaatagtaaaataaaagagcaacatatttcattctctggacatgcaattaatttttcatctc |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13309076 |
agcagaaccattgcaacaaaaatagtaaaataaaagagcaacatatttcattctctggacatgcaattaatttttcatctc |
13308996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University