View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4682-Insertion-7 (Length: 243)
Name: NF4682-Insertion-7
Description: NF4682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4682-Insertion-7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 8 - 243
Target Start/End: Complemental strand, 10976210 - 10975975
Alignment:
| Q |
8 |
aaaactacctcaaaaaccaaaactctcaaccaacatcatccactgcagcacaaaccaagaaaaaccaagcaacgatgtaaactcaaatctaaaagcattc |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10976210 |
aaaattacctcaaaaaccaaaactctcaaccaacatcatccactgcagcacaaaccaagaaaaaccaaccaacgatgtaaactcaaatctaaaagcattc |
10976111 |
T |
|
| Q |
108 |
tcagcagcactagcactctcatcaatcctcatctcatcaccactccccgctgtcgccgacatctccggtctaacaccatgcagagaatcaaaacaattcg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10976110 |
tcagcagcactagcactctcatcaatcctcatctcatcaccactccccgctgtcgccgacatctccggcctaacaccatgcagagaatcaaaacaattcg |
10976011 |
T |
|
| Q |
208 |
ccaaacgtgagaaacaatcaatcaaaaagcttgaat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
10976010 |
ccaaacgtgagaaacaatcaatcaaaaagcttgaat |
10975975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University