View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4682_low_16 (Length: 321)
Name: NF4682_low_16
Description: NF4682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4682_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 298
Target Start/End: Complemental strand, 16906208 - 16905923
Alignment:
| Q |
19 |
atccgaggtaccatagttaatgtcctattcctttaatatctcactttttctcaattctaccccttatatcctttttcactaatatcatcatcaccaattc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16906208 |
atccgaggtaccatagttaatgtcctattcctttaatatctcactttttctcaattctaccccttatatcttttttcactaatatcatcatcaccaattc |
16906109 |
T |
 |
| Q |
119 |
cttttgctttgt---cttcactcactaagtacatgatcttccccttttctatctg------tctctatctaaccatctctagtcattttatcaatccttt |
209 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||||||||||||||||| |||| |
|
|
| T |
16906108 |
cttttgctttgtcttcttcactcactaagtacatgatcttccccttttctatctgtctctatctctatctcactatctctagtcattttatcaat-cttt |
16906010 |
T |
 |
| Q |
210 |
tctttgccaaactcannnnnnnnncttgctatttttgaaacaagatttagtgcaatgagattatccaagttaatattgatagttatgtt |
298 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16906009 |
tctttaccaaactca--tttttttcttgctatttttgaaacaagatttagtgcaatgagattatccaagttgatattgatagttatgtt |
16905923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University