View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4682_low_17 (Length: 308)
Name: NF4682_low_17
Description: NF4682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4682_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 17 - 292
Target Start/End: Complemental strand, 47296683 - 47296410
Alignment:
| Q |
17 |
atgaagtgcaaacaattaaaaaagaacaacnnnnnnnnnatttaaattgtagataacataaaaacttgtaaataacttcgttaacatggtctaatcaaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47296683 |
atgaagtgcaaacaattaaaaaagaacaacttttttt--atttaaattgtagataacataaaaacttgtaaataacttcgttaacatggtctaatcaaaa |
47296586 |
T |
 |
| Q |
117 |
acatcaaaatacaacttcaagttaatatcactttgggtatgaattaatatatcattcttgaaggtgtgcaacaaatttttgggtgaagtttgtttctata |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47296585 |
acatcaaaatacaacttcaagttaatatcactttgggtatgaattaatatatcattcttgaaggtgtgcaacaaatttttgggtgaagtttgtttctata |
47296486 |
T |
 |
| Q |
217 |
ctttgttgcatcggtttgagggattattttggagtgatggagcaatttttaggggtttaatgtgtagggctgaagt |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47296485 |
ctttgttgcatcggtttgagggattattttggagtgatggagcaatttttaggggtttaatgtgtaaggctgaagt |
47296410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University