View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4682_low_21 (Length: 256)
Name: NF4682_low_21
Description: NF4682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4682_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 19208233 - 19208364
Alignment:
| Q |
1 |
tgaaagcaaggttgagacagtggcagaggaggttgaagagctatctgattcggatggaaaagatgtcgcaaaagagatggctaaggcagaagcacggaga |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19208233 |
tgaaatcaaggttgagacagtggcagaggaggttgaagagctctctgattcggatgggaaagatgtcgcaaaagagatggctaaggcagaagcacggaga |
19208332 |
T |
 |
| Q |
101 |
ctggccaagggtaagggagaagcggtggatat |
132 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| |
|
|
| T |
19208333 |
ctggccaagggcaagggagaaacggtggatat |
19208364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 19208098 - 19208229
Alignment:
| Q |
1 |
tgaaagcaaggttgagacagtggcagaggaggttgaagagctatctgattcggatggaaaagatgtcgcaaaagagatggctaaggcagaagcacggaga |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| | || ||||||||||| ||||| |
|
|
| T |
19208098 |
tgaaagcaaggttgagacagtggctgaggaggttgaagagctatctgattcggatgaaaaagatgtcgcaaaagagacgactgaggcagaagcagggaga |
19208197 |
T |
 |
| Q |
101 |
ctggccaagggtaagggagaagcggtggatat |
132 |
Q |
| |
|
|||||||||| |||||| ||||||||||||| |
|
|
| T |
19208198 |
gtggccaagggcaagggataagcggtggatat |
19208229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 19207963 - 19208094
Alignment:
| Q |
1 |
tgaaagcaaggttgagacagtggcagaggaggttgaagagctatctgattcggatggaaaagatgtcgcaaaagagatggctaaggcagaagcacggaga |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||| ||||||||| |||||||||||||||||||||| | ||||||||||| || || |
|
|
| T |
19207963 |
tgaaagcaaggttgagacagtggtagaggaggttgaagagctctctaattcggatgaaaaagatgtcgcaaaagagatgattgaggcagaagcaaggtga |
19208062 |
T |
 |
| Q |
101 |
ctggccaagggtaagggagaagcggtggatat |
132 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |
|
|
| T |
19208063 |
gtggccaagggcaagggagaagcggtggatat |
19208094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 4 - 128
Target Start/End: Original strand, 19207825 - 19207955
Alignment:
| Q |
4 |
aagcaaggttgagacagtggcagaggaggttgaagagctatctgattcggatggaaaagatgtcgcaaaagaga------tggctaaggcagaagcacgg |
97 |
Q |
| |
|
||||||| |||||| ||||| |||||||||||||||||| | ||||| ||||| |||||||||||||||| | || | ||||||||||| || |
|
|
| T |
19207825 |
aagcaagcttgagatagtgggagaggaggttgaagagctctatgattaggatgagaaagatgtcgcaaaaggaaaaggtgtgagtgaggcagaagcaggg |
19207924 |
T |
 |
| Q |
98 |
agactggccaagggtaagggagaagcggtgg |
128 |
Q |
| |
|
||| |||||||||| |||||||||||||||| |
|
|
| T |
19207925 |
agagtggccaagggcaagggagaagcggtgg |
19207955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University