View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4682_low_22 (Length: 253)
Name: NF4682_low_22
Description: NF4682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4682_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 38052359 - 38052126
Alignment:
| Q |
1 |
actaggttgtatgctttttaatataattaaatcccaatttaaagagcaccaaaacatcaacttacagagatttaaacaatttgttatggtttgtatttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38052359 |
actaggttgtatgctttttaatataattaaatcccaatttaaagagcaccaaaacatcaacttacagagatttaaacaatttgttatggtttgtatttta |
38052260 |
T |
 |
| Q |
101 |
gtttcagactctatcaaaaagtttgatggaactatgtttaaaatccggcggttttggagatactttttagagaaaggttttgttgaaccnnnnnnngaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
38052259 |
gtttcagactctatcaaaaagtttgatggaactatgtttaaaatccggcagttttggagatactttttagagaaagattttgttgaaccaaaaaaagaag |
38052160 |
T |
 |
| Q |
201 |
aaaatttcaagagtttgaagtttagggcaattct |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38052159 |
aaaatttcaagagtttgaagtttagggcaattct |
38052126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 182
Target Start/End: Original strand, 40254061 - 40254122
Alignment:
| Q |
119 |
aagtttgatggaactatgtttaaaatccggcggttttggagatactttttagagaaaggttttg |
182 |
Q |
| |
|
||||||||| ||||||||||||||| || | |||| |||||||| ||||||||||| |||||| |
|
|
| T |
40254061 |
aagtttgatcgaactatgtttaaaacccagtggttatggagata--ttttagagaaaagttttg |
40254122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University