View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4682_low_25 (Length: 240)
Name: NF4682_low_25
Description: NF4682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4682_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 48023462 - 48023253
Alignment:
| Q |
18 |
agacaaggagcttccacacaatatgttcttgctctacttgtacctgaatctgaataagacacagtgatgaccggttcatactccttttttgtagcctaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48023462 |
agacaaggagcttccacacaatatgttcttgctctacttgtacctgaatctgaataagacacagtgatgaccggttcatactccttttttgtagcctaaa |
48023363 |
T |
|
| Q |
118 |
tctcaccgaccaatttctcaatttagaatggccacaaacagctccgcccaaggaccataaaacatatcaagctcaatgttcaacaggttttgagccagcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48023362 |
tctcaccgaccaatttctcaatttagaatggccacaaacagctccgcccaaggaccataaaacatatcaagctcaatgttcaacaggttttgagccagcc |
48023263 |
T |
|
| Q |
218 |
aacctttgct |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
48023262 |
aacctttgct |
48023253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University